View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21391_low_14 (Length: 264)
Name: NF21391_low_14
Description: NF21391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21391_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 12 - 247
Target Start/End: Complemental strand, 51907439 - 51907207
Alignment:
| Q |
12 |
atgagaagaacgaaccatttagcaaaagcactgccatctttggcacgaacgagaacggaagcggaacgagagtcgacggcatcaacccttttcgtacctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51907439 |
atgagaagaacgaaccatttagcaaaagcactgccatctttggcacgaacgagaacggaagcggaacgagaatcgacggcatcaacccttttcgtacctt |
51907340 |
T |
 |
| Q |
112 |
tcgttgccatttcgtaacgtgctctctgatttaaccctaatttcttaatcttggatcgaaatagcagccaagtgcttgaatatatatgagttgagatctg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
51907339 |
tcgttgccatttcgtaacgtgctctctgatttaaccctaatttcttaatcttggatcgaaat---agccaagtgtttgaatatatatgagttgagatctg |
51907243 |
T |
 |
| Q |
212 |
taattaaattgaaaggagggaaaaactgaataattt |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
51907242 |
taattaaattgaaaggagggaaaaactgaataattt |
51907207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 14 - 58
Target Start/End: Complemental strand, 6113719 - 6113675
Alignment:
| Q |
14 |
gagaagaacgaaccatttagcaaaagcactgccatctttggcacg |
58 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
6113719 |
gagaagaacgaaccatttggcgaaagcactgccatctttggcacg |
6113675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University