View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21391_low_20 (Length: 226)
Name: NF21391_low_20
Description: NF21391
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21391_low_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 162
Target Start/End: Original strand, 53805211 - 53805357
Alignment:
| Q |
16 |
ttctaactccggtaactttttctccaaaattgaactctcttcttttaaattagcttccttatttttcccttctccgttttctgtctcactcacgttaact |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805211 |
ttctaactccggtaactttttctccaaaattgaactctcttctttcaaattagcttccttatttttcccttctccgttttctgtctcactcacgttaact |
53805310 |
T |
|
| Q |
116 |
ccgttagatttaacacactcacttttctgagtcacgtgaccgttaac |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53805311 |
ccgttagatttaacacactcacttttctgagtcacgtgaccgttaac |
53805357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University