View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21392_high_18 (Length: 331)
Name: NF21392_high_18
Description: NF21392
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21392_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 10 - 239
Target Start/End: Complemental strand, 25254761 - 25254532
Alignment:
| Q |
10 |
gcagagagaagtagatcattagctctggtatacagtggcatgtaccttggatcggtcactggattggccttttcacctttcctaattcatcagtatggat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25254761 |
gcagagagaagtagatcattagctctggtatacagtggcatgtaccttggatcggtcactggattggccttttcacctttcctaattcatcagtatggat |
25254662 |
T |
 |
| Q |
110 |
ggccatcggtgttttactcctttggttctctaggaacagtttggttttgcatatggcttagtaaggttagaatcctcataaataaaaattattaccttca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
| T |
25254661 |
ggccatcggtgttttactcctttggttctctaggaacagtttggttttgtatatggcttagtaaggttagaattcgcatacataaaaattattaccttca |
25254562 |
T |
 |
| Q |
210 |
cataaatgcttcctttatgaaatatatgta |
239 |
Q |
| |
|
||||||||||||||||| |||||||||||| |
|
|
| T |
25254561 |
cataaatgcttcctttacgaaatatatgta |
25254532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 13 - 134
Target Start/End: Complemental strand, 11319857 - 11319736
Alignment:
| Q |
13 |
gagagaagtagatcattagctctggtatacagtggcatgtaccttggatcggtcactggattggccttttcacctttcctaattcatcagtatggatggc |
112 |
Q |
| |
|
|||||||| |||||| | || || ||||| ||||||||||||||||| || ||||| || |||| || || ||||||||||| || | | |||||||| |
|
|
| T |
11319857 |
gagagaagcagatcacttgcactagtatatagtggcatgtaccttggttctgtcacaggcttgggattctcgcctttcctaatccaaaaatttggatggc |
11319758 |
T |
 |
| Q |
113 |
catcggtgttttactcctttgg |
134 |
Q |
| |
|
|||| ||||| ||||| ||||| |
|
|
| T |
11319757 |
catctgtgttctactcatttgg |
11319736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University