View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21393_low_14 (Length: 273)
Name: NF21393_low_14
Description: NF21393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21393_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 4292472 - 4292252
Alignment:
| Q |
1 |
tgcatgggttatttttgctggggatcaggtacatatattgaatgaatgttcttgttnnnnnnnnnnnnnnnnnnnntgaacgctcttgttataataatca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
4292472 |
tgcatgggttatttttgctggggatcaggtacatatattgaatgaatgttcttgttaaagaaaaagaaaagaaaaatgaaagctcttgttataataatca |
4292373 |
T |
 |
| Q |
101 |
aaattaatctaggaatacaaacttagtgttgggagacttgacaacaagactctccatcaagaaaagaactcgagctcgattcttggcatcgccaatgtgt |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||| | |
|
|
| T |
4292372 |
aaattaatctaggaatacaaactcagtgttgggagacttgacaacaagactctccatcaagaaaagaactcgagctcgattattggcatcaccaatgtat |
4292273 |
T |
 |
| Q |
201 |
acgagataatctaaccctaat |
221 |
Q |
| |
|
| |||||| |||||||||||| |
|
|
| T |
4292272 |
aggagatagtctaaccctaat |
4292252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University