View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21393_low_18 (Length: 256)
Name: NF21393_low_18
Description: NF21393
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21393_low_18 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 11 - 147
Target Start/End: Original strand, 22080447 - 22080583
Alignment:
| Q |
11 |
atcatcaaaaacaaaatagaaatgcagttcaatagatctttgatatgtctttgattaaaatgacttctgaaacaattttagttcgaaaaattgatttaat |
110 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||| |||||| ||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
22080447 |
atcatcaaatacaaaacagaaatgcagttcaatagatctttgatacgtctttcattaaaatgacttctcaaacaattttagttcgaaaaactgatttaat |
22080546 |
T |
 |
| Q |
111 |
gcaagaaggaaaaccgatctattgaaatgttgttcac |
147 |
Q |
| |
|
||||||||||||||||||||||| || |||||||||| |
|
|
| T |
22080547 |
gcaagaaggaaaaccgatctatttaagtgttgttcac |
22080583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 181 - 241
Target Start/End: Original strand, 22080648 - 22080708
Alignment:
| Q |
181 |
aaacacaaacattgcaagaaatgacctaaaaattggaattgaaaaaatgtaagacaaattt |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| || |||||||||| |||||||| |
|
|
| T |
22080648 |
aaacacaaacattgcaagaaatgatctaaaaattggaactggaaaaatgtaaaacaaattt |
22080708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University