View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21394_low_3 (Length: 470)
Name: NF21394_low_3
Description: NF21394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21394_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 411; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 411; E-Value: 0
Query Start/End: Original strand, 22 - 460
Target Start/End: Original strand, 21482827 - 21483265
Alignment:
| Q |
22 |
attgcagccacaattacggttgttgaccataatttaaaacttattcaagttcaataacaaatgattttgcattaacatgcatttctaataatcacacatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
21482827 |
attgcagccacaattacggttgttgaccataatttaaaacttattcaagttcaataacaaatgattttgcatttacatgcatttctaataatcacacatc |
21482926 |
T |
|
| Q |
122 |
gtagatcatataaacaaccaaaacatatgatctaacaataatatacagcttaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21482927 |
gtagatcatataaacaaccaaaacatataatctaacaataatataaagctgaagtccacaaacctgtctcctatcggatgcacttcgaccctggtgagaa |
21483026 |
T |
|
| Q |
222 |
ctctgtgtctgcatggtggggcggtcacggtccactggaggctgcgtcggctcagccggaacaacaggtgccaaggaagctgctgtcccaccggtcatag |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
21483027 |
ctctgtgtctgcatggtggggcggtcacggtccactggaggctgcgtcggctcagccggaacaacaggtgccaaggaggctgctgtcccaccggtcatag |
21483126 |
T |
|
| Q |
322 |
tctgccaatacatccagttcgctggatttgcatgagaaccaccagcagcaacattggtgcaattatcaccactacctaatctcgcaagtggatcagaacc |
421 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21483127 |
tctgccaatacatccagttcgctggatttgcatgagaaccaccagcagcaacattggtgcaactatcaccactacctaatctcgcaagtggatcagaacc |
21483226 |
T |
|
| Q |
422 |
ttgaatattctgatgatggttattattatgatgcctatg |
460 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21483227 |
ttgaatattctgatgatggttaatattatgatgcctatg |
21483265 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University