View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21394_low_6 (Length: 296)
Name: NF21394_low_6
Description: NF21394
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21394_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 26 - 201
Target Start/End: Original strand, 2265268 - 2265444
Alignment:
| Q |
26 |
tattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgtcccgtat |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2265268 |
tattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttttgtatgatattattgtgttccgtat |
2265367 |
T |
 |
| Q |
126 |
ttac-ttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttggtcttttggtat |
201 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
2265368 |
ttactttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttgatcttttagtat |
2265444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 34
Target Start/End: Complemental strand, 2265267 - 2265234
Alignment:
| Q |
1 |
ttattttgacattttagagacatgttattttgtc |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2265267 |
ttattttgacattttagagacatgttattttgtc |
2265234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University