View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21395_high_18 (Length: 223)
Name: NF21395_high_18
Description: NF21395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21395_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 54859703 - 54859908
Alignment:
| Q |
1 |
tgatgaagttatggtccagtgtgatcactgcactgattggtaattttaacattacctgtactttatatttatcttgtactctgnnnnnnng---tatatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||| |
|
|
| T |
54859703 |
tgatgaagttatggtccagtgtgatcactgcactgattggtaattttaacattacctgtactttatatttatcttgtactctgtttttttgctttgtatt |
54859802 |
T |
 |
| Q |
98 |
tttggttttctggactctcgtacgtctgtctggttctatgaaaagaaaacaattatatattttaagtcggcattaaccatatgagcataatttttcctag |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54859803 |
tttggttttctggactctcgtacgtctgtctggttctatgaaaagaaaacaat----tattttaagtcggcattaaccatatgagcataatttttcctag |
54859898 |
T |
 |
| Q |
198 |
tgtaaattct |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
54859899 |
tgtaaattct |
54859908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University