View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21395_low_11 (Length: 308)
Name: NF21395_low_11
Description: NF21395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21395_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 104 - 268
Target Start/End: Original strand, 48068025 - 48068187
Alignment:
| Q |
104 |
tttaaattttaactgtctgatctaaaattaacgattcagatagattaaactgattttattattttgtaatctgtcatccgatctcatattaataatcaag |
203 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||||| ||||| |||||||||||||| |||||| |
|
|
| T |
48068025 |
tttaaatttcaactgtctgatctaaaattaacgattcaaattgattaaactggttttattattttgtaatctatcatcggatctcatattaatgatcaag |
48068124 |
T |
|
| Q |
204 |
accgtttattgtgtgaaaacacatatttatgatatatatcatggaaaacccacaaactattagta |
268 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
48068125 |
accgttaattgtgtgaaaacac--atttatgatatatatcatggaaaatccacaaactattagta |
48068187 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 18 - 110
Target Start/End: Original strand, 48067908 - 48067996
Alignment:
| Q |
18 |
aatactagcatttctgtgatgattaatgatcaaatagtatgtgaatgtgatagttcatacataattcagtcttatccgataaacattttaaat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
48067908 |
aatactagcatttctgtgatgattaatgatcaaatagtatgtgaatgtgatagtt----cataattcagtcttatcagataaacattttaaat |
48067996 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University