View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21395_low_17 (Length: 227)
Name: NF21395_low_17
Description: NF21395
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21395_low_17 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 7 - 201
Target Start/End: Original strand, 2826495 - 2826681
Alignment:
| Q |
7 |
ttattatgcaaaatgcaaacgttacgttttgtttgtttcgatgatttgttttggttgtatttccatcaaatcaagtttttaactttctcccttttctttt |
106 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2826495 |
ttattatgcaaaatgcaaccgttacgttttgtttgtttcgat--------ttggttgtatttccatcaaatcaagtttttaactttctcccttttctttt |
2826586 |
T |
|
| Q |
107 |
atgaacaaaagtgttgttttacaaaacatgcacatctttcagaacaaatagcatggtacatatacgcatggataccattagcgggttttccttta |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2826587 |
atgaacaaaagtgttgttttacaaaacatgcacatctttcggaacaaatagcatggtacatatacgcatggataccattagcgggtttttcttta |
2826681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University