View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_high_27 (Length: 276)
Name: NF21397_high_27
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 126 - 240
Target Start/End: Original strand, 41434300 - 41434414
Alignment:
| Q |
126 |
gggttatgagttagtcatgaatctttataaaaaggaggttatttcatggtctaccgtaagctttaggtaagaattgaaaaacctctcttggtaaacatga |
225 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41434300 |
gggttatgagttagtcatgaatctttataaaaaggaggttatttcttggtctaccgtaagctttaggtaagaattgaaaaacctctcttggtaaacatga |
41434399 |
T |
 |
| Q |
226 |
gattcaacaaaaccc |
240 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41434400 |
gattcaacaaaaccc |
41434414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 126 - 237
Target Start/End: Complemental strand, 41567220 - 41567106
Alignment:
| Q |
126 |
gggttatgagttagtcatgaatctttataaaaaggaggttatttcatggtctaccgt---aagctttaggtaagaattgaaaaacctctcttggtaaaca |
222 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
41567220 |
gggttattagttagtcatgaatctctataaaaaggaggttatttcttggtctaccgtaagaagctttagggaagaattgaaaaacctctcttggcaaact |
41567121 |
T |
 |
| Q |
223 |
tgagattcaacaaaa |
237 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
41567120 |
tgagattcaacaaaa |
41567106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 41434175 - 41434236
Alignment:
| Q |
1 |
catattcatgaacattatcactttttaaggtacaaatatattgatacacgtcagaaagtgtg |
62 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41434175 |
catattcatgaacattatcacttcttaaggtacaaatatattgatgcacgtcagaaagtgtg |
41434236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University