View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_high_34 (Length: 238)
Name: NF21397_high_34
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_high_34 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 19 - 238
Target Start/End: Complemental strand, 41702616 - 41702397
Alignment:
| Q |
19 |
tctaagttctaacacattgacttctagtggggattaatggtctaaatcgccttttggtttccgaaaatgcaacaccaatgcctcattctcaatgtatcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41702616 |
tctaagttctaacacattgacttctagtggggattaatggtctaaatcgccttttggtttccgaaaatgcaacaccaatgcctcattctcaatgtatcaa |
41702517 |
T |
|
| Q |
119 |
agtattattgacactgtgtttaaggaatgagagcgctttcatagctgtcaaaaattctttgttgctcacctcggttaactattcatgaaggggaagctgt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41702516 |
agtattattgacactgtgtttaaggaatgagagcgctttcatagctgtcaaacattctttgttgctcacctcggttaactattcatgaaggggaagctgt |
41702417 |
T |
|
| Q |
219 |
tggtctatatcaagcttgtt |
238 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41702416 |
tggtctatatcaagcttgtt |
41702397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University