View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_high_35 (Length: 238)
Name: NF21397_high_35
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_high_35 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 41433677 - 41433817
Alignment:
| Q |
18 |
aggataatgtgatgaaatctagccgtacaaagaatttggaaacataactttttgaaaccggcttgcaaatttttctctagaactaattagaataaaataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
41433677 |
aggataatgtgatgaaatctagccgtacaaagaatttggaaacataactttttgaaacatgcttgccaa-ttttctctagaactaattagaataaaataa |
41433775 |
T |
 |
| Q |
118 |
nnnnnnnnaatgatcagacaattataattgattaaaaatgta |
159 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
41433776 |
ttttttttaatgatctgacaattataattgattaaaaatgta |
41433817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University