View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_high_37 (Length: 226)
Name: NF21397_high_37
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_high_37 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 94 - 226
Target Start/End: Complemental strand, 1061068 - 1060936
Alignment:
| Q |
94 |
gatgatatacgaatacgaccatgcatattgattattcaagtctccaattttgaataagaattggtctcttctttgagagatattttttgacggatctttc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1061068 |
gatgatatacgaatacgaccatgcatattgattattcaagtctccaattttgaataagaattagtctcttctttgagagatattttttgacggatctttc |
1060969 |
T |
 |
| Q |
194 |
ttgagagatatgtatacttaaaaatagccgact |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1060968 |
ttgagagatatgtatacttaaaaatagccgact |
1060936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 2 - 71
Target Start/End: Complemental strand, 1061161 - 1061092
Alignment:
| Q |
2 |
ttggtctttattgtacgtacgtatgtataaatttcaaattccaaattataatatgaagaatccatgtcac |
71 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1061161 |
ttggtctttattgtacgtacatatgtataaatttcaaattccaaattataatatgaagaatgcatgtcac |
1061092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University