View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_high_38 (Length: 218)
Name: NF21397_high_38
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_high_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 2e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 28790991 - 28790857
Alignment:
| Q |
18 |
agatgccatgaagctgcagaaacaaggaatcatggtgtgttctcatcctgcttagattgctttctttcaggaggtcaactctacctttttcagtatggtg |
117 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28790991 |
agatgccgtgaagctgcagaaacaaggaatcatggtgtgttctcatcctgcttagattgctttctttcagggggtcaactctacctttttcagtatggtg |
28790892 |
T |
|
| Q |
118 |
tatccaaactacaatttttagcccaagctagagga |
152 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28790891 |
tatccaaactacagtttttagcccaagctagagga |
28790857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 148 - 217
Target Start/End: Original strand, 28790808 - 28790877
Alignment:
| Q |
148 |
gaggaaggacctcttcagttggatccgaagaagctagggtgcatgtacctcctctagcttgggctaaaaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28790808 |
gaggaaggacctcttcagttggatccgaagaagctagggtgcatgtacctcctctagcttgggctaaaaa |
28790877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University