View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_low_25 (Length: 293)
Name: NF21397_low_25
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 26 - 275
Target Start/End: Original strand, 40272795 - 40273044
Alignment:
| Q |
26 |
tgattgctttctcccaaataatataagtttgagttacagtgtcaaattcttatatcataaaaggttgtggcatattcattatcttttataaagtattgga |
125 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272795 |
tgattgctttctctcaaataatataagtttgagttacaatgtcaaattcttatatcataaaaggttgtggcatattcattatcttttataaagtattgga |
40272894 |
T |
 |
| Q |
126 |
tcttgttttttctcagacaatgcttgtggcgtattctttcatttatcactattatcaacagtttatgtgatgttggatttctaatgtattttctatttgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272895 |
tcttgttttttctcagacaatgcttgtggcgtattctttcatctatcactattatcaacagtttatgtgatgttggatttctaatgtattttctatttgg |
40272994 |
T |
 |
| Q |
226 |
attgaagaacgtcgatcacgatcaagttgccaataactcatttccttggt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40272995 |
attgaagaacgtcgatcacgatcaagttgccaataactcatttccttggt |
40273044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University