View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_low_36 (Length: 240)
Name: NF21397_low_36
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 8 - 224
Target Start/End: Complemental strand, 41942436 - 41942220
Alignment:
| Q |
8 |
acatcatcaaaccgactcaagtgagttgaaaaacacatattgctttcatggatggttaaaattagattgttgatgggaaagacattgaaatattcaactt |
107 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942436 |
acatcatcaaaccgactcaagtgggttgaaaaacacatattgcttccatggatggttaaaattagattgttgatgggaaagacattgaaatattcaactt |
41942337 |
T |
 |
| Q |
108 |
ataactttagcaaaagtggcccaaaccaaaaggaaatgaagttcatgtaagtaatatagtttcactgaccatagaaagcggatggattgaatttgacaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942336 |
ataactttagcaaaagtggcccaaaccaaaaggaaatgaagttcatgtaagtaatatagtttcactgaccatagaaagcggatggattgaatttgacaag |
41942237 |
T |
 |
| Q |
208 |
gtccttacacatgtaac |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
41942236 |
gtccttacacatgtaac |
41942220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University