View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21397_low_37 (Length: 240)
Name: NF21397_low_37
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21397_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 25011192 - 25010967
Alignment:
| Q |
1 |
atttgtttttaaactgaaactcaccgcacctctctaaggatacttaaaaatgagcagacagaagtttacgctgttaccatttttgctttttactagacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011192 |
atttgtttttaaactgaaactcaccgcacctctctaaggatacttaaaaatgagcagacagaagtttacgctgttaccatttttgctttttactagacaa |
25011093 |
T |
 |
| Q |
101 |
gtctgtttattctgcaactgactagatgatatttcatttgaatttggctcctttgtaggcgttggaaagatgtgagtattggcgcttgtcggatcagcag |
200 |
Q |
| |
|
||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011092 |
gtctgtttattttgcaactgactagatgacatttcatttgaatttggctcctttgtaggcgttggaaagatgtgagtattggcgcttgtcggatcagcag |
25010993 |
T |
 |
| Q |
201 |
ggaaaaccccctggcgttatgggatg |
226 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
25010992 |
ggaaaaccccctggtgttatgggatg |
25010967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University