View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21397_low_39 (Length: 238)

Name: NF21397_low_39
Description: NF21397
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21397_low_39
NF21397_low_39
[»] chr7 (1 HSPs)
chr7 (18-159)||(41433677-41433817)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 41433677 - 41433817
Alignment:
18 aggataatgtgatgaaatctagccgtacaaagaatttggaaacataactttttgaaaccggcttgcaaatttttctctagaactaattagaataaaataa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||| || ||||||||||||||||||||||||||||||    
41433677 aggataatgtgatgaaatctagccgtacaaagaatttggaaacataactttttgaaacatgcttgccaa-ttttctctagaactaattagaataaaataa 41433775  T
118 nnnnnnnnaatgatcagacaattataattgattaaaaatgta 159  Q
            ||||||| ||||||||||||||||||||||||||    
41433776 ttttttttaatgatctgacaattataattgattaaaaatgta 41433817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University