View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21398_high_9 (Length: 241)
Name: NF21398_high_9
Description: NF21398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21398_high_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 20 - 132
Target Start/End: Complemental strand, 47478045 - 47477933
Alignment:
| Q |
20 |
acacaaacacaaacacaaactgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47478045 |
acacaaacacaaacacaaactgaactaattcctcatgtctcacttggaacccaaggctttcaggtatcatcacttcactcacttgtacacttacacttac |
47477946 |
T |
 |
| Q |
120 |
atatacaattgtc |
132 |
Q |
| |
|
|||||||| |||| |
|
|
| T |
47477945 |
atatacaaatgtc |
47477933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 35 - 84
Target Start/End: Complemental strand, 47487078 - 47487029
Alignment:
| Q |
35 |
caaactgaactaattcctcatgtctcacttggaacccaaggctttcaggt |
84 |
Q |
| |
|
||||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47487078 |
caaaccgagctaattcctcatgttacacttggaacccaaggctttcaggt |
47487029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University