View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21398_low_8 (Length: 260)
Name: NF21398_low_8
Description: NF21398
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21398_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 175; Significance: 3e-94; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 175; E-Value: 3e-94
Query Start/End: Original strand, 48 - 251
Target Start/End: Complemental strand, 38988858 - 38988656
Alignment:
| Q |
48 |
gcaacaaataaaaagacactgtttctcaaagcaatatataccaaaaatgttgaattgattagcgtatatatttacaattaaacttttaatgttgcttagg |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38988858 |
gcaacaaataaaaagacactgtttctcaaagcaatatataccaaaaatgttgaattgattagcgtatatatttacaattaaacttttaatgttgcttagg |
38988759 |
T |
 |
| Q |
148 |
agtataataaagtagcttgatgcataaaatcaacatctagaagctacgcggatgatttgagcaagctgaactannnnnnncattctaagtttcttcccct |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
38988758 |
agtataataaagtagcttgatgcataaaatcaacatctagaagctacgcggatgatttgagcaagctgaactatttttttcattctaagtttc-tcccct |
38988660 |
T |
 |
| Q |
248 |
ttgc |
251 |
Q |
| |
|
|||| |
|
|
| T |
38988659 |
ttgc |
38988656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University