View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2139_low_11 (Length: 276)
Name: NF2139_low_11
Description: NF2139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2139_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 22 - 272
Target Start/End: Complemental strand, 27425840 - 27425579
Alignment:
| Q |
22 |
cagttgcaacattgaataaagtgtttttactcaccttccatccacaatctagatgccaatatttcgctatatat-----------tatggttagcatttg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27425840 |
cagttgcaacattgaataaagtgtttttactcaccttccatccacaatctagatgccaatatttcgctatatataacagttcctttatggttagcatttg |
27425741 |
T |
 |
| Q |
111 |
cccttcttgaactttatcttcttctccaaatcatgtcaccaaaagaacaattagaaacttgaataatcaccaaccattcactcattcttctctttcacgt |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27425740 |
cccttcttgaactttatcttcttctccaaatcatgtcaccaaaagaacaattagaaacttgaataatcaccaaccattcactcattcttctctttcacgt |
27425641 |
T |
 |
| Q |
211 |
ggccaccataagcctgtcataaatacgactctcctatggtgacgttctctttcttctctctc |
272 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
27425640 |
ggccaccataagcctgtcataaatgcggctctcctatggtgacgttctctttcttctctctc |
27425579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University