View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2139_low_14 (Length: 251)
Name: NF2139_low_14
Description: NF2139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2139_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 3485735 - 3485955
Alignment:
| Q |
16 |
ataactacttgtccaagatgaaaaacaccattacttcttaaatgtctaacattatttggcacaaagtagttcttttgaagataaacctttttgcttgagg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |||||| |
|
|
| T |
3485735 |
ataactacttgtccaagatgaaaaacaccattacttcttaaatgtctaacattatttggcacaaagcagttcttttgaaggtaaacctttttgtttgagg |
3485834 |
T |
 |
| Q |
116 |
actgctttggaatcttattcctacaacaaataacttaattaggtagggtgtgcttttgaataacgtgcaactttttgtgggaggatgcaattgttatgac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
3485835 |
actgctttggaatcttattcctacaacaaataacttaattaggtagggtgtgcttctgaataacgtgcaactttttgtggaaggatgcagttgttatgac |
3485934 |
T |
 |
| Q |
216 |
catctatttcttaaatgtgat |
236 |
Q |
| |
|
||||||||| ||||||||||| |
|
|
| T |
3485935 |
catctattttttaaatgtgat |
3485955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University