View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2139_low_19 (Length: 220)
Name: NF2139_low_19
Description: NF2139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2139_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 3e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 12 - 111
Target Start/End: Complemental strand, 27939190 - 27939091
Alignment:
| Q |
12 |
gagatgaacaagagagacaacgtgagggagttgcttcaaggtggttggcctggatttctgggtcaaaatcaaaaggagcaacttctgaatgatgataata |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27939190 |
gagaagaacaagagagacaacgtgagggagttgcttcaaggtggttggcctggatttctgggtcaaaatcaaaaggagcaacttctgaatgatgataata |
27939091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 119 - 203
Target Start/End: Complemental strand, 27938889 - 27938805
Alignment:
| Q |
119 |
gagagtagtggtcttttctatgtagatctctattgctatagtcttgatgcacacttttataacaaagaaacgttaatattaatat |
203 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27938889 |
gagagtagtggtcttttctatatagatctctattgctatagtcttgatgcacacttttataacaaagaaacgttaatattaatat |
27938805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University