View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2139_low_7 (Length: 388)
Name: NF2139_low_7
Description: NF2139
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2139_low_7 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 1 - 380
Target Start/End: Complemental strand, 40990922 - 40990543
Alignment:
| Q |
1 |
tttttcaccttataatcctatgctcttctccttcataaatgttttgcttcttagaagttcatttcttgccttttcctccatgatttcttctgcaacttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40990922 |
tttttcaccttataatcctatgctcttctccttcataaatgttttgcttcttagaagttcatttcttgccttttcctccatgatttcttctgtaacttat |
40990823 |
T |
 |
| Q |
101 |
tttttgcaataacattttatatttctgtttcctttcatttcctctatgcttgtatatgctctaaactgcttgtggatatttttaactttgcagcattttt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40990822 |
tttttgcaacaacattttatatttctgtttcctttcatttcctctatgcttgtatatgctctaaactgcttgtggatatttttaactttgcagcattttt |
40990723 |
T |
 |
| Q |
201 |
atattaatagcagctctgtgtttgccataatcttactgtaaatatgctatactgtgcagtgctatcttgtatactttgataatcacaatgttgattctat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40990722 |
atattaatagcagctctgtgtttgccataatcttactgtaaatttgctatactgtgcagtgctatcttgtatactttgataatcacaatgtggattctat |
40990623 |
T |
 |
| Q |
301 |
ctttaccgattcaacaatttgtggtttcgacaacgtattagtctcttcttgtcaaaatgaaacacttgctagtgatgatg |
380 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40990622 |
ctttaccgattcaataatttgtggtttcgacaacgtattagtctcttctggtcaaaatgaaacacttgctagtgatgatg |
40990543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University