View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21401_low_6 (Length: 296)
Name: NF21401_low_6
Description: NF21401
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21401_low_6 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 2265243 - 2265444
Alignment:
| Q |
1 |
acatgtctctaaaatgtcaaaataatattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2265243 |
acatgtctctaaaatgtcaaaataatattttgtccaccaaacatagatcatacaacataaaaagttgctcaatactttaaaggtttgtcatatgttgttt |
2265342 |
T |
 |
| Q |
101 |
tgtatgatattattgtgtcccgtatttac-ttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttggtcttttggt |
199 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || |
|
|
| T |
2265343 |
tgtatgatattattgtgttccgtatttactttttagtatatcaaacacacctttttccttcacgggtttctaattagttctaataacttgatcttttagt |
2265442 |
T |
 |
| Q |
200 |
at |
201 |
Q |
| |
|
|| |
|
|
| T |
2265443 |
at |
2265444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University