View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21402_high_5 (Length: 251)
Name: NF21402_high_5
Description: NF21402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21402_high_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 8 - 231
Target Start/End: Complemental strand, 39076443 - 39076220
Alignment:
| Q |
8 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtatttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076443 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtttttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
39076344 |
T |
|
| Q |
108 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076343 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
39076244 |
T |
|
| Q |
208 |
cttgttttactttttcataaatgc |
231 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
39076243 |
cttgttttactttttcataaatgc |
39076220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University