View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21402_low_10 (Length: 235)
Name: NF21402_low_10
Description: NF21402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21402_low_10 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 3 - 235
Target Start/End: Original strand, 28407277 - 28407509
Alignment:
| Q |
3 |
tatattgcttatagaataatgttaacaatccatataacttttacgtctgctgaaaaatagataaggaactttatctggagtggggacactgaaaaaagga |
102 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28407277 |
tatattgcttatggaataatgttaacaatccatataacttttacgtctgctgaaaaatagataaggaactttatctggagtggggacactgaaaaaagga |
28407376 |
T |
 |
| Q |
103 |
aattgatcacagtcacttggaataaaacctgtagacctctttctcagggtttaaacatcagatcactctcttcccttaatgaagcttcaaatcttaaact |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28407377 |
aattgatcacagtctcttggaataaaacctgtagacctctttctcagggtttaaacatcagatcactctcttcccttaatgaagcttcaaatcttaaact |
28407476 |
T |
 |
| Q |
203 |
ttgctaggacttcagaaattcaactcaagcttg |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28407477 |
ttgctaggacttcagaaattcaactcaagcttg |
28407509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University