View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21402_low_5 (Length: 300)
Name: NF21402_low_5
Description: NF21402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21402_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 200; Significance: 1e-109; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 64 - 287
Target Start/End: Complemental strand, 40766266 - 40766043
Alignment:
| Q |
64 |
ttctcccactagattaaggatttacatagtttttgaaatttcgttgcttgccgaaaggcattaagctattgcacgtttatattgcaattcgaggagcttc |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
40766266 |
ttctcccactagactaaggatttacatagtttttgaaatttcgttgcttgccgaaaggaattaagctattgcatgtttatattgcaattcgaggagcttc |
40766167 |
T |
|
| Q |
164 |
taaggagacttgtatataattatcaaccataaaaccaactacaactcattgaatcaatcgtgtgcctataaatagttggtagaatcatgcgcctataata |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
40766166 |
taaggagacttgtatataattatcaaccataaaaccaactacaactcattgaatcaatcgtgtgcctataaatagttggtagaatcatgtgcctataata |
40766067 |
T |
|
| Q |
264 |
agttgtttcaatcctctatgatga |
287 |
Q |
| |
|
||||||||||||||| ||| |||| |
|
|
| T |
40766066 |
agttgtttcaatcctatataatga |
40766043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 40766375 - 40766303
Alignment:
| Q |
1 |
gagaaaactttgctatgcttgtgtggatgtgcccttttcaactc--aaaatcattgccgtcaaacttctccca |
71 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
40766375 |
gagaaaactttactatgcttgtgtggatgtgcctttttcaactcaaaaaatcattgccgtcaaacttcaccca |
40766303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University