View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21402_low_6 (Length: 293)
Name: NF21402_low_6
Description: NF21402
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21402_low_6 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 25011426 - 25011720
Alignment:
| Q |
1 |
ttgtcttgctacaaaaagattgtaaacaaattccactaagctggtgaaactagtatatctgaaa-cacgttgctttgtcaaattatcgtttcgtgtaagt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
25011426 |
ttgtcttgctacaaaaagattgtaaacaaattccactaagctggtgaaactagtatatctgaaaacacgttgctttgtcaaattatcgtttcgaaaaagt |
25011525 |
T |
 |
| Q |
100 |
gctatacactattcgaagaattccacaggattgaagagtaagtttgaagagaaattattgaaaccgtcaagttgagtactcacagagtgaagaatccctt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25011526 |
gctatacactattcgaagaattccacaggattgaagagtaagtttgaagagaaattattgaaaccgtcaagttgagtactcacagagtgaagaatccctt |
25011625 |
T |
 |
| Q |
200 |
tggttgtaacatcaaatgcacctgcagtaccaccagcagcactgatccagtcaacgatcctctgcctgtgtgcatcttgatgatg-tccatctca |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
25011626 |
tggttgtaacatcaaatgcacctgcagtaccaccagcagcactgatccagtcaacgatcctctgcctgtgtgcatcttgattatgatccatctca |
25011720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University