View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21404_low_5 (Length: 316)
Name: NF21404_low_5
Description: NF21404
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21404_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 49 - 275
Target Start/End: Complemental strand, 47431880 - 47431652
Alignment:
| Q |
49 |
aagggagtagaagaagatgaaatagattagagttgtttgaaccgaagttgaataaatgacacattgttgatttgttgtcaatattgaatttggagtttgc |
148 |
Q |
| |
|
||||||| ||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47431880 |
aagggaggcgaagaggatgaaatagattagagttgtttgaaccgaagttgaagaaatgacacattgttgatttgttgtcaatattgaatttggagtttgc |
47431781 |
T |
|
| Q |
149 |
tattttattaaatttagga---nnnnnnnncccttaattttggacttgtgaaatttattgggcnnnnnnnnatatataaaataatgttaatttgttccct |
245 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47431780 |
tattttattaaatttaggattttttttttttccttaattttggacttgtgaaatctattgggc-tttttttatatataaaataatgttaatttgttccct |
47431682 |
T |
|
| Q |
246 |
aaacataagttaagaaactaaacatacaaa |
275 |
Q |
| |
|
||| |||||||||||||||||||||||||| |
|
|
| T |
47431681 |
aaatataagttaagaaactaaacatacaaa |
47431652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 8 - 68
Target Start/End: Complemental strand, 47431989 - 47431929
Alignment:
| Q |
8 |
gatgaagggaggagttgaggatgaaggcatgaagctgatcgaagggagtagaagaagatga |
68 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47431989 |
gatgaagggaggagttgaggatgaaggcatgaagctgatcgaagggagtagaagaagatga |
47431929 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University