View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21405_low_4 (Length: 402)
Name: NF21405_low_4
Description: NF21405
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21405_low_4 |
 |  |
|
| [»] scaffold0050 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0050 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 143 - 387
Target Start/End: Complemental strand, 73268 - 73021
Alignment:
| Q |
143 |
gacatctcaaatggataaaccaaaccatctttgtagaaaatgaattatgttgttacttcagtagtgaacaatataaaagttgcattgaattgtcttgatt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73268 |
gacatctcaaatggataaaccaaaccatctttgtagaaaatgaattatgttgttacttcagtagtgaacaatataaaagttgcattgaattgtcttgatt |
73169 |
T |
 |
| Q |
243 |
atagtctttttcatcatgtatcttaattc-ttgattttgatttcttatattattgttattagatctttaaaatgggtctaaggatatcaaatagtcaaag |
341 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73168 |
atagtctttttcatcatgtatcttaattctttgattttgatttcttatattattgttattagatctttaaaatgggtctaaggatatcaaatagtcaaag |
73069 |
T |
 |
| Q |
342 |
agttcaaatac--atgtcacgaacatagatattgaattatattgattt |
387 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
73068 |
agttcaaatacatatgtcacgaacatagatattgaattatattgattt |
73021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050; HSP #2
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 73417 - 73506
Alignment:
| Q |
1 |
ttttatgatcggtgcacaagatatggcagaatgagtcccatgatgaagagcacaccaatgtattcaatcaattcaaatccttgcgttttt |
90 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
73417 |
ttttatgatcggtgcacaatatatggcagaatgagtcccatgatgaagagcacaccaatgtattcaatcaattcaaatccttgcgttttt |
73506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University