View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_high_16 (Length: 399)
Name: NF21406_high_16
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 25 - 263
Target Start/End: Original strand, 19325527 - 19325765
Alignment:
| Q |
25 |
gataaagttaagactagacccttaaccatataagacacgagcttttgctccccgtgggtcacatggaacatgcttgccaagaaaatggcgcatgtgaagg |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19325527 |
gataaagttaagactagacccttaaccatataagacaagagcttttgctccccgtgggtcacatggaacatgcttgccaagaaaatggcgcatgtgaagg |
19325626 |
T |
 |
| Q |
125 |
cttccaacaactataaatttcccaagagaaatttcctacacttgaaattcatttaggttgataaatttatctaagataaattgaaataataaaatccnnn |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19325627 |
cttccaacaactataaatttcccaagagaaatttcctacacttgaaattcatttaggttgataaatttatctaagataaattgaaataataaaatccaaa |
19325726 |
T |
 |
| Q |
225 |
nnnntaatatctccagcatcaagttacgtcatttagaag |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19325727 |
aaaataatatctccagcatcaagttacgtcatttagaag |
19325765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 338 - 382
Target Start/End: Original strand, 19325841 - 19325885
Alignment:
| Q |
338 |
ttcagctagtgaaccttgtattttgttgtttgggatgatcaccac |
382 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19325841 |
ttcagctagtgaaccttgtattttgttgtttgggatgatcaccac |
19325885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University