View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_high_46 (Length: 208)
Name: NF21406_high_46
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_high_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 19 - 195
Target Start/End: Original strand, 42975433 - 42975609
Alignment:
| Q |
19 |
ccatccatatccatatgccataatctctccattctgctcacaaccgtcatgtgataatcgttccttccattgaaacatatcgagtctctcaacttcaata |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42975433 |
ccatccatatccatatgccataatctctccattctgctcacaaccgtcatgtgataatcgttccttccattgaaagatatcgagtctctcaacttcaata |
42975532 |
T |
|
| Q |
119 |
aaagagtcacctactccatctctaggttcatactaacctctcattttcgactttacaaaatatctcccacctttgct |
195 |
Q |
| |
|
||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42975533 |
aaacagtcacctactccatctctagtttcatactaacctctcattttcgactttacaaaatatctcccaccattgct |
42975609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University