View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_high_48 (Length: 202)
Name: NF21406_high_48
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_high_48 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 1e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 185
Target Start/End: Original strand, 44624623 - 44624807
Alignment:
| Q |
1 |
ccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44624623 |
ccagcagtgaggacgatggaagaagtagcattggcgccagagagaccggcggcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgt |
44624722 |
T |
|
| Q |
101 |
cacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctcaggttcaaggtttagtctgtg |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44624723 |
cacggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaaggctctgtttctcaggttcaaggtttagtctgtg |
44624807 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 4 - 185
Target Start/End: Original strand, 44635875 - 44636056
Alignment:
| Q |
4 |
gcagtgaggacgatggaagaagtagcattggcgccagagagaccggcagcgagggcgaaagggacggtgaggccatcggaaacgccaatgatgatgtcac |
103 |
Q |
| |
|
|||||||||| || |||||| | | ||||||||||||||||||||||||| || ||||| || || ||||| || || || | || || |||||||||| |
|
|
| T |
44635875 |
gcagtgaggatgacggaagaggcaacattggcgccagagagaccggcagcaagagcgaatggaacagtgagtccgtcagaggcaccgataatgatgtcac |
44635974 |
T |
|
| Q |
104 |
ggacgatttcacccgcggtgaagtgcttttcagtgtggcgattgagaagactctgtttctcaggttcaaggtttagtctgtg |
185 |
Q |
| |
|
|||| || ||||| |||||||| |||| ||||||||| ||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
44635975 |
ggactatgtcaccggcggtgaaatgctcctcagtgtggttattgagaaggatctgtttctcaggttcaagggttagtctgtg |
44636056 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University