View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_high_8 (Length: 455)
Name: NF21406_high_8
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 15 - 439
Target Start/End: Complemental strand, 36791471 - 36791024
Alignment:
| Q |
15 |
cacagactatttatgcttatcccaaccactacttctagtgtctctctctacatataatgtgaatgttgtttgattaacccatttta-----------att |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
36791471 |
cacagactatttatgcttatcccaaccactacttctagtgtctctctctacatataatgtgaatgttgtttgatgaacccattttactttttaacttatt |
36791372 |
T |
|
| Q |
104 |
ctcaatggcacctactgcagcaatgcttttgctccctcaatattatggaagatcatcaatgaccctgccaccctcatcctcatccccacctaaaaccact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36791371 |
ctcaatggcacctactgcagcaatgcttttgctccctcaatattatggaagatcatcaatgaccctgccaccctcatcc------ccacctaaaaccact |
36791278 |
T |
|
| Q |
204 |
tattttgggatgaaagcctcatcactgaagtattggatcaccaattacatacaatccaggaatcaaaaaccaccagattcacactcatgactgtttgcat |
303 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
36791277 |
tattttgggatgaaagcctcatcacttaagtattggatcaccaattacatacaatccaggaatcaaaaaccaccagattcacactcatgactgcttgcat |
36791178 |
T |
|
| Q |
304 |
ggttgaggtttgaagatgccctttaactttgcagctgctactaatgtaatgacttatatgatccgtagagcttttgct------------------tgta |
385 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
36791177 |
ggttgaggtttgaagatgccctttaactttgcagctgctactaatgtaatgacttatatgatccgtagagcttttgcttgtagttatgttttttcttgta |
36791078 |
T |
|
| Q |
386 |
attatgatgttttcttttgacaatatgtaactttgatgttataaaacagctttt |
439 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36791077 |
attatgatgttttcttttgacaataggtaactttgatgttataaaacagctttt |
36791024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University