View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_low_19 (Length: 380)
Name: NF21406_low_19
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 7 - 364
Target Start/End: Original strand, 6608488 - 6608850
Alignment:
| Q |
7 |
gaagcaaaggccaacgggttttgttcatcatcaaacttcaccgtctcagattgggataagaactgtggatgtggataacacttgtaacttctccaccact |
106 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
6608488 |
gaagaaaaggccaatgggttttgttcatcatcaaacttcaccgtctcagattgggataagaaccgtggatgtggataacacttgtaacttctccaccact |
6608587 |
T |
 |
| Q |
107 |
tcaaatctatccatctccatagttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgta-----tt |
201 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
6608588 |
tcaaatctatgcatctccatatttacttggaatatgaatggtcaggtactagagtcacttgactactccctccgtttctttttaactgtcgtatttgctt |
6608687 |
T |
 |
| Q |
202 |
tgctgacaaaattttatttctatttagttgttgttttaaagtttaattcaacattattatttaatttggcatgaattaatcaggtttcgtttgaagattt |
301 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6608688 |
tgctgacaaaattttatttctatttagttgttgtttcaaagtttaattcaacattattatttaatttggcgtgaattaatcaggtttcgtttgaagattt |
6608787 |
T |
 |
| Q |
302 |
agcagaaatggttagtagcaaccgagatttcgatcttctagctgttggcttgcaagaagctcc |
364 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6608788 |
agcagaaatggttggtagcaaccgagatttcgatcttctagctgttggcttgcaagaagctcc |
6608850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University