View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21406_low_32 (Length: 269)

Name: NF21406_low_32
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21406_low_32
NF21406_low_32
[»] chr1 (1 HSPs)
chr1 (208-252)||(1141241-1141285)


Alignment Details
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 208 - 252
Target Start/End: Complemental strand, 1141285 - 1141241
Alignment:
208 tgctatctccatctagtccatccctaacaagcagatagcaattgt 252  Q
    |||||||||||||||||||||||||||| ||||||||||||||||    
1141285 tgctatctccatctagtccatccctaactagcagatagcaattgt 1141241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University