View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_low_37 (Length: 249)
Name: NF21406_low_37
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 34 - 226
Target Start/End: Original strand, 1927513 - 1927711
Alignment:
| Q |
34 |
tctaaaatatctcgttaactgacccatctttcattgtaataaaggagctgtgttgatgcaacacaacagaagtgtatgatgcttattttttaaagaagtc |
133 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927513 |
tctaaaatatctcgttaactgacccgtctttcattgtaa---aggagcagtgttgatgcaacacaacagaagtgtatgatgcttattttttaaagaagtt |
1927609 |
T |
 |
| Q |
134 |
aaaatgaattagattactattcttaa---------gtgttagataaaaatcaaaagttcataaagttaagttataacataaacagacttcacaaaaaata |
224 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
1927610 |
aaaatgaatttgattactattcttaagcattaggtgtgttagataaaaatcaaaaggtcataaggttaagttataacataaacagactccacaaaaaata |
1927709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University