View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_low_41 (Length: 237)
Name: NF21406_low_41
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 96 - 220
Target Start/End: Complemental strand, 1927519 - 1927399
Alignment:
| Q |
96 |
ttttacaatttcctagcaaggctgttgaccttctacaatcttatgtctaatctaattgattgttcaaatcaacaacaaaattgcatagtcactcgatcct |
195 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1927519 |
ttttagaatttcctagcaaggctgttgaccttccacaa----atgtctaatctaattgattgttcaaatcaacaacaaaattgcatagtcactcgatcct |
1927424 |
T |
|
| Q |
196 |
ttatcatatgtgtagattaatctaa |
220 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
1927423 |
ttatcacatgtgtagattaatctaa |
1927399 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University