View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21406_low_43 (Length: 227)
Name: NF21406_low_43
Description: NF21406
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21406_low_43 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 11 - 227
Target Start/End: Complemental strand, 42975797 - 42975581
Alignment:
| Q |
11 |
cacagaaaatcaagggacgatcaataagtatcccaagttaggagcagaagtacnnnnnnnnnnnnnccaaagcaaaattaatgcacattttttaaaaggt |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42975797 |
cacacaaaatcaagggacgatcaataagtatcccaagttaggagcagaagtacaaaaataaaaaaaccaaagcaaaattaatgcacattttttaaaaggt |
42975698 |
T |
 |
| Q |
111 |
catggctgacgataaaggagccatggctagacggcaggagcttttgagagcactttaatctgttgtttaatgtggctgacgataaagaagcaatggtggg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42975697 |
catggctgacgataaaggagccatggctagacggcaggagcttttgagagcactttaatcggttgtttaatgtggctgacgataaagaagcaatggtggg |
42975598 |
T |
 |
| Q |
211 |
agatattttgtaaagtc |
227 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
42975597 |
agatattttgtaaagtc |
42975581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University