View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_high_21 (Length: 295)
Name: NF21408_high_21
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_high_21 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 6e-80; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 96 - 288
Target Start/End: Complemental strand, 33009596 - 33009407
Alignment:
| Q |
96 |
aattaacaatgtagttggttgatttttgcattgaatttgtacaaaagcaatgaaaggaaagttgaaacaacatagagatagatatgttgggattatactt |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33009596 |
aattaacaatgtagttggttgatttttgcattgaatttgtacaaaagcaatgaaaggaaagttgaaacaacatagcgatagatatgttgggattatactt |
33009497 |
T |
 |
| Q |
196 |
ccttaaccactgtctaacattctcccgattgattatataattttaggttttgtattataccttcgcatgtctctcttcgtatgttttcatctc |
288 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
33009496 |
cctta---actgtctaacattctcctgattgattatataattataggttttgtattataccttcccatatctctctctgtatgttttcatctc |
33009407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 33009723 - 33009671
Alignment:
| Q |
18 |
aaaggtaagtattttgagttaggagtattcatatggtcttgtgtgctatcgatg |
71 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33009723 |
aaaggtaagtattttgagttag-agtattcatatggtcttgtgtgctatcgatg |
33009671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University