View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21408_high_36 (Length: 226)

Name: NF21408_high_36
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21408_high_36
NF21408_high_36
[»] chr4 (1 HSPs)
chr4 (15-208)||(53958346-53958539)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 15 - 208
Target Start/End: Original strand, 53958346 - 53958539
Alignment:
15 atgaaattagaaatttagagtatagtttaaaattggattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtaga 114  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53958346 atgaaattagaaatttagagtatagtttaaacttggattcaccgtaggaagagccatggggctactaggctcgaattgtttcatagggttatcaagtaga 53958445  T
115 acaagtgatccatgttgtggctcaggcttcagagcctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgactcagggtgtgcat 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
53958446 acaagtgatccatgttgtggctcaggcttcagagcctgtacagcaaagttacaccaagcaagtgaaaggaaatccattgagtcagggtgtgcat 53958539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University