View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_16 (Length: 349)
Name: NF21408_low_16
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 309
Target Start/End: Complemental strand, 3272883 - 3272575
Alignment:
| Q |
1 |
atctatgagaagagtcggctcaacgagtggcgacaagaggaagaactgcagtcattgatataatcagtatggctcatagtatattgattgatgcatactg |
100 |
Q |
| |
|
||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272883 |
atctatgctaagaggcggctcaacgagttgcgacaagaggaagaactgcagtcattgatataatcagtatggctcatagtatattgattgatgcatactg |
3272784 |
T |
 |
| Q |
101 |
caaaattggatgagatattactacttgagtaacataagaggtgtggaaagggttactgagcaagattacacaacaaatttttcttcttccttttgttgtc |
200 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272783 |
caaaattggatgagatcttactacttgagtaacataagaggtgtggaaagggttactgaacaagattacacaacaaatttttcttcttccttttgttgtc |
3272684 |
T |
 |
| Q |
201 |
tacaatgacactcttcttttttggtccttccatatcactgacttttatatgaattaaattttcatttcaacggtgattgcgtggaggatcagaaccatgt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272683 |
tacaatgacactcttcttttttggtccttccatatcactgacttttatatgaattaaattttcatttcaacggtgattgcgtggaggatcagaaccatgt |
3272584 |
T |
 |
| Q |
301 |
atatatgag |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
3272583 |
atatatgag |
3272575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 305 - 349
Target Start/End: Original strand, 3272145 - 3272189
Alignment:
| Q |
305 |
atgagctccctagaattaatcgttcaggaaaaactaagttcgatt |
349 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
3272145 |
atgagctctctagaattaatcgttcaggaaaaactaagttcgatt |
3272189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University