View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_18 (Length: 330)
Name: NF21408_low_18
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 197 - 311
Target Start/End: Complemental strand, 37622571 - 37622457
Alignment:
| Q |
197 |
attaactgaaaccatataaataagtgattaactacttacattaaacattaatggttaatgagatactctaagtggtacttgcattaaaccatattcgtca |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37622571 |
attaactgaaaccatataaataagtgattaactacttacagtaaacattaatggttaatgagatactctaagtggtacttgcattaaatcatattcgtcg |
37622472 |
T |
|
| Q |
297 |
actagtattagaaat |
311 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37622471 |
actagtattagaaat |
37622457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 44 - 138
Target Start/End: Complemental strand, 37622724 - 37622630
Alignment:
| Q |
44 |
gtgaatattatgcttgtatttacttgattagtagtcttgaaagaatattaaccaataaaaatatttgaggagtgcaaagaatacttattgtgaca |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37622724 |
gtgaatattatgcttgtatttacttgattagtagtcttgaaagaatattaaccaataaaaatatttgaggagtgcaaagaatacttgttgtgaca |
37622630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University