View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_26 (Length: 277)
Name: NF21408_low_26
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 3 - 197
Target Start/End: Complemental strand, 33009421 - 33009227
Alignment:
| Q |
3 |
gtatgttttcatctctgacaaatgatgagagatatatcttacttagtaatttttgatgtctcgctcagttaatttgtatgatagtattaatatccaacag |
102 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
33009421 |
gtatgttttcatctctgacaaatgacgagagatatatcttacttagtaatttttgatgtctcgctcagttaatttgtatgatagtattaatatctaagag |
33009322 |
T |
 |
| Q |
103 |
tgggttgtgactataaatctaactctacgtctatcaactaacatacatgaacgaattactccaaattcgttatctaaaaagtatttgtgaaacac |
197 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33009321 |
tggattgtgactataaatctaactctacgtctatcaactaacatacatgaacgaattactccaaattcgttatctaaaaagtatttgtgaaacac |
33009227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University