View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_27 (Length: 258)
Name: NF21408_low_27
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_27 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 2144472 - 2144261
Alignment:
| Q |
18 |
aataccaccagatcaacccaagtaaattttaatagttgaaaaattgaagatcgattttaagtcttaacaaagaaaagaactatcataacaattaatatat |
117 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
2144472 |
aataccaccagatcaacccaaatgaattttaatagttgaaaaattgaagatcgattttaagtcttaacaaagaaaagagctatcataacaattaatatat |
2144373 |
T |
|
| Q |
118 |
gctcaacttggtaattaagcaaggacatcccgataacaattaatatattaaattcgagaggtcccatgtttgaagggaaaaatttgatctagtggtgaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |||||| |
|
|
| T |
2144372 |
gctcaacttggtaattaagcaaggacatcccgataacaattaatatattaaattcgagaggtcccatgtttgaagggaaaagtttgatctaatagtgaaa |
2144273 |
T |
|
| Q |
218 |
atatacatcatc |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2144272 |
atatacatcatc |
2144261 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University