View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_30 (Length: 247)
Name: NF21408_low_30
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 1573621 - 1573839
Alignment:
| Q |
17 |
caaaatgttggatagagcaattcataaaatcttgtacacannnnnnn-cttcagacaattccaagaacagtgctttttgatcagaagactggaactaatt |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1573621 |
caaaatgtttgatagagcaattcataaaaccttgtacacaatttttttcttcagacaattccaagaacagtgctttttgatcagaagactggaactaatt |
1573720 |
T |
 |
| Q |
116 |
tgcttcaatggccagtagaagaagtagaaagcttaagactgagtagtgatgaatatgcagaagtagttgttacacctggctctattgttccattgaacat |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1573721 |
tgcttcaatggccagtagaagaagtagaaagcttaagactgagtagtgatgaatatgcagaagtagttgttacacctggctctgttgttccattgaacat |
1573820 |
T |
 |
| Q |
216 |
tactcaagcaacacaggtt |
234 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
1573821 |
tactcaagcaacacaggtt |
1573839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University