View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21408_low_31 (Length: 242)

Name: NF21408_low_31
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21408_low_31
NF21408_low_31
[»] chr3 (1 HSPs)
chr3 (18-242)||(25968731-25968954)


Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 25968731 - 25968954
Alignment:
18 gtagaatggttgagatacgatgagttaagtacacgtatttatatgcgtaaggtgggtgctaaacggtgtcgttttggtttcgtgaatttggtgaccggga 117  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
25968731 gtagaatggttgagatacgatgagttaaggacacgtatttatatgcgtaaggtgggtgctaaacggtgtcgttttggttttgtgaatttggtgaccggga 25968830  T
118 accggttggtggcggtgactagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatatttttgtctccttttattttttcacgaaaac 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||  ||||||||||||||||||    
25968831 accggttggtggcggtgactagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatttttttgtctcc--ttattttttcacgaaaac 25968928  T
218 ttg-ttctttgtcttgcttcattgtt 242  Q
    ||| || |||||||||||||||||||    
25968929 ttgtttttttgtcttgcttcattgtt 25968954  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University