View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_31 (Length: 242)
Name: NF21408_low_31
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 242
Target Start/End: Original strand, 25968731 - 25968954
Alignment:
| Q |
18 |
gtagaatggttgagatacgatgagttaagtacacgtatttatatgcgtaaggtgggtgctaaacggtgtcgttttggtttcgtgaatttggtgaccggga |
117 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
25968731 |
gtagaatggttgagatacgatgagttaaggacacgtatttatatgcgtaaggtgggtgctaaacggtgtcgttttggttttgtgaatttggtgaccggga |
25968830 |
T |
 |
| Q |
118 |
accggttggtggcggtgactagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatatttttgtctccttttattttttcacgaaaac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||| |
|
|
| T |
25968831 |
accggttggtggcggtgactagatgtagggaccactgctacgtggggtgacgtggtttgctatgggatttttttgtctcc--ttattttttcacgaaaac |
25968928 |
T |
 |
| Q |
218 |
ttg-ttctttgtcttgcttcattgtt |
242 |
Q |
| |
|
||| || ||||||||||||||||||| |
|
|
| T |
25968929 |
ttgtttttttgtcttgcttcattgtt |
25968954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University