View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21408_low_35 (Length: 238)
Name: NF21408_low_35
Description: NF21408
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21408_low_35 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 238
Target Start/End: Complemental strand, 3273348 - 3273127
Alignment:
| Q |
17 |
accaatatccaaaagaagcttctgttttaagatcagcaggtggaggaaattggtttcaccagtttagagcagttgctttaatcagggtttctccattccc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3273348 |
accaatatccaaaagaagcttctgttttaagatcagctggtggaggaaattggtttcaccagtttagagcagttgctttaatcagggtttctccattccc |
3273249 |
T |
|
| Q |
117 |
ttacatgatctataactattgtgctactgcaacaaatgttcaatatggtccttacttgtgtggatctttggcaggaatgttaccagaagtaattgcttcg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3273248 |
ttacatgatctataactattgtgctactgcaacaaatgttcaatatggtccttacttgtgtggatctttggcaggaatgttaccagaagtaattgcttcg |
3273149 |
T |
|
| Q |
217 |
atttacacgtaggatctctctt |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3273148 |
atttacacgtaggatctctctt |
3273127 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 156
Target Start/End: Complemental strand, 42166012 - 42165890
Alignment:
| Q |
34 |
gcttctgttttaagatcagcaggtggaggaaattggtttcaccagtttagagcagttgctttaatcagggtttctccattcccttacatgatctataact |
133 |
Q |
| |
|
|||||| || ||| ||| || |||| |||||| |||||||| ||||||||||| ||||| ||||||||| ||||||| |||||||| ||| ||| || | |
|
|
| T |
42166012 |
gcttctattctaaaatctgctggtgcaggaaactggtttcatcagtttagagctgttgccttaatcaggatttctccgttcccttatatggtcttcaatt |
42165913 |
T |
|
| Q |
134 |
attgtgctactgcaacaaatgtt |
156 |
Q |
| |
|
| |||||| |||||||||||| |
|
|
| T |
42165912 |
actgtgctgtggcaacaaatgtt |
42165890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University